ZFIN ID: ZDB-ALT-190123-288
Genomic Feature: sa44640
Synonyms:
Affected Genomic Regions: herc2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 37784011 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILSNo data available
FLANKING SEQUENCE
AGACCGTGCTCCAGAGTGGCTGGTCAGTGCTACTCCCCACTGCAGAGGAA
C/T
GAGCAAGAGCCCTGTCCTCGCTGCTGCCCAATGCAGGTCAGTGCATGAAA
(1)
OTHER sa44640 PAGES
ZMP:sa44640 (1)
GENOTYPESNo data available

CITATIONS  (1)