header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190123-195
Genomic Feature: sa44537
Synonyms:
Affected Genomic Regions: pappa2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 2: 35096192 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE
TGGAAGCGGCGGGATGGAGTCTGCAACCCAGAATGCAACAGCATTCACTA
T/A
GATTACGATGATGGTGATTGCTGTGACCCTGAGGTTACAGATGTCGCAAA
(1)
OTHER sa44537 PAGES
ZMP:sa44537 (1)
GENOTYPES No data available

CITATIONS  (1)