ZFIN ID: ZDB-ALT-190123-17
Genomic Feature: sa20752
Synonyms:
Affected Genomic Regions: herc2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 6: 37845173 (GRCz10) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
FLANKING SEQUENCE
CCTCAGAGAGTGAGGAGAGGGTCAGTCCGCACCCCTGGATGGACAGCAAA
C/T
GAGGAGAGGTGAGGAGTTCTGCCAATTCTTGACTGTGTGTGTGTATGTAT
(1)
OTHER sa20752 PAGES
ZMP:sa20752 (1)
GENOTYPESNo data available

CITATIONS  (1)