header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190123-115
Genomic Feature: sa37991
Synonyms:
Affected Genomic Regions: cyp19a1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 25: 4893568 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
FLANKING SEQUENCE
TGCTAGTCTTATCAACTCTGCCTCCTTCTCAGGTTCCCAGTCGTTACTTC
C/T
AGCCATTCGGTTGTGGTCCGCGGGCCTGTGTTGGGAAGCACATTGCTATG
(1)
OTHER sa37991 PAGES
ZMP:sa37991 (1)
GENOTYPES No data available

CITATIONS  (1)