header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-190123-104
Genomic Feature: sa34937
Synonyms:
Affected Genomic Regions: si:dkey-250d21.1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 10: 32073189 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
FLANKING SEQUENCE
AACCACCCGAATGTGCAGAAACTAATAAAGAGGCATTGAAAGCTGCATTA
C/T
AGTCCGCTCTCACCGCAGCATATAGCAGGCAAAGCAGAGTCACTGATCAA
(1)
OTHER sa34937 PAGES
ZMP:sa34937 (1)
GENOTYPES No data available

CITATIONS  (1)