ZFIN ID: ZDB-ALT-190108-3
Genomic Feature: el660
Synonyms:
Affected Genomic Regions: foxf1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-foxf1
Lab Of Origin: Crump Lab
Location: Chr 18: 30847576 - 30847609 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 34 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
AATAAAAAGTCCATAAACGCGGGTTTTTAAATAGTGGTCTAGTTATACTGATTTTGGTGAAGCCCACTTTAGAATAGCTGACAGTGGGAGGGACACTGGGCGGCCCCTGCGCGACTCTGCCATGCCCATGCTCAAGAGCCTGAGAGGAACTGATGGAAACAGATAAGTAAAAGCCCAACTCCTAAAGGAAGGACAAGAAGACTGGATCTCGATAGGAAGCCGAATGAATCTTTTCCCTGCTGTGTTCAGTTTTATGTTGAGTAGTGCTTAGACAGTAGGCCAGTGTGAAATTACGTACAAAGAAAGAACTTAAAGCAGCGCAGTCCGTTTCTAATGATAAAAGTTTAGAAACTTAAGTTTTTTTTTCATCGTGGATTTTGACGTGCGCGTAAACGTGAAGAATGACGGCTGAAGTGCAGCAACCCTCTGTGCAGACCCCCGCTCACAGTAGCCCCATGACGGAGAAACCCGTCCAGACGCCTGTGATGGAGACCTCCTCT
TCCTCCTCAAGCACGAAAGCAAAAAAGACCAACG/-
CTGGAATTCGTCGTCCCGAAAAGCCCCCGTATTCTTACATCGCTCTTATTGTCATGGCCATCCAGAGCTCTCCAACCAAACGACTCACTTTAAGCGAAATTTATCAGTTCCTCCAGAGCCGCTTCCCATTTTTTAGAGGATCGTATCAGGGCTGGAAAAACTCTGTGCGTCACAATCTGTCTCTGAATGAATGCTTCATCAAGCTACCCAAGGGTCTAGGCAGACCTGGAAAGGGTCACTACTGGACCATCGACCCAGCCAGTGAGTTCATGTTTGAGGAGGGATCCTTCCGCAGGAGGCCGCGGGGATTCAGACGCAAATGCCAGGCGCTCAAACCTTCCATGTACAGCATGATGAACGGGCTGGGATTCAATCACATACCCGAGTCCTATAACTTTCAGGGGGGCGGCGGGGGCCTGTCTTGTCCTCCAAACAGTTTATCTTTGGAGAGTGGAATTGGGATGATGAATGGACATTTGGCTAGCAATATGGAAGGAATG
OTHER el660 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)