ZFIN ID: ZDB-ALT-190104-1
Genomic Feature: el658
Synonyms:
Affected Genomic Regions: foxf1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-foxf1
Lab Of Origin: Crump Lab
Location: Chr 18: 30847610 - 30847638 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 30 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
TGGTCTAGTTATACTGATTTTGGTGAAGCCCACTTTAGAATAGCTGACAGTGGGAGGGACACTGGGCGGCCCCTGCGCGACTCTGCCATGCCCATGCTCAAGAGCCTGAGAGGAACTGATGGAAACAGATAAGTAAAAGCCCAACTCCTAAAGGAAGGACAAGAAGACTGGATCTCGATAGGAAGCCGAATGAATCTTTTCCCTGCTGTGTTCAGTTTTATGTTGAGTAGTGCTTAGACAGTAGGCCAGTGTGAAATTACGTACAAAGAAAGAACTTAAAGCAGCGCAGTCCGTTTCTAATGATAAAAGTTTAGAAACTTAAGTTTTTTTTTCATCGTGGATTTTGACGTGCGCGTAAACGTGAAGAATGACGGCTGAAGTGCAGCAACCCTCTGTGCAGACCCCCGCTCACAGTAGCCCCATGACGGAGAAACCCGTCCAGACGCCTGTGATGGAGACCTCCTCTTCCTCCTCAAGCACGAAAGCAAAAAAGACCAACG
CTGGAATTCGTCGTCCCGAAAAGCCCCCG/-
TATTCTTACATCGCTCTTATTGTCATGGCCATCCAGAGCTCTCCAACCAAACGACTCACTTTAAGCGAAATTTATCAGTTCCTCCAGAGCCGCTTCCCATTTTTTAGAGGATCGTATCAGGGCTGGAAAAACTCTGTGCGTCACAATCTGTCTCTGAATGAATGCTTCATCAAGCTACCCAAGGGTCTAGGCAGACCTGGAAAGGGTCACTACTGGACCATCGACCCAGCCAGTGAGTTCATGTTTGAGGAGGGATCCTTCCGCAGGAGGCCGCGGGGATTCAGACGCAAATGCCAGGCGCTCAAACCTTCCATGTACAGCATGATGAACGGGCTGGGATTCAATCACATACCCGAGTCCTATAACTTTCAGGGGGGCGGCGGGGGCCTGTCTTGTCCTCCAAACAGTTTATCTTTGGAGAGTGGAATTGGGATGATGAATGGACATTTGGCTAGCAATATGGAAGGAATGGGCTTGGCAGGACACTCTATGCCCCATCT
OTHER el658 PAGES No links to external sites

CITATIONS  (1)