header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-180705-1
Genomic Feature: x50
Synonyms:
Affected Genomic Regions: sox2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN2-sox2
Lab Of Origin: Riley Lab
Location: Chr 22: 37349711 - 37349718 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 8 bp deleted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
CTCGGGTGCTGCGGGTAACCCAGCTGCTCCTGCATCATGCCGTAGCCTCCGTTGGTCCAGCCGTTCATATGCGCGTAGCTGTCCATCCTCTGGTTGACCCCGGCGCCCAAACCGGCCCCTACACCCACGCCGGCGCCCATGCCGTTGCCGCCCGGCGCCAGGAGCCCGCCCGGCAGGGTGTACTTGTCCTTCTTCATCAGGGTCTTGGTTTTCCTCCGGGGTCTGTATTTGTAATCCGGGTGTTCCTTCATGTGCAGAGCCCGAAGGCGTTTGGCTTCGTCGATGAATGGTCGCTTCTCGCTCTCGGACAGAAGTTTCCACTCGGCCCCGAGTCGCTTACTTATTTCCGAATTGTGCATTTTGGGGTTCTCCTGTGCCATTTTCCGCCGCTGTCCCCTCGACCACACCATGAAGGCGTTCATGGGTCTCTTGATGCGGTCCGGGCTGTTTTTCTGGTTGTTTCCCGAGGAGTTGGTGTTCCCCGTGCCCCCGGTGTTGGG
CTGGGGCG/-
CCGGGGGCTTCAGCTCGGTTTCCATCATGTTATACATTTAAACCGATTTTCTCGAAAGTCTACCCCACCAGCCGTAAAAATAAAAAATAAAGAAGTCCAAAAAGTGTGTGGAGAGGCTGCTGAAGTTACCTTAGCAGTTGGAGGTAACTTTGCTGGGAAAAGAAGCGCTCTTAGGTCCTGTTGTGCCCACAAACTTCTTTTCTTAGTCTTGAAGAATCAACACAAACTCGGTTTCCCTCCTCGCCAGAGCCCTTGTCAACTCCTGATACTTTTTGAACAAGTTAATAGACAACCATTCATAGAGCGACTGTCAGCGAATATAAATGGGTTTGTCGCTGACCAATCAGAGCGCGTCTGCTCCCTCGGTTTGCATAAAGGGGCGGGGTTACGGACGGTCAGCAGTGCAGCGCAGAGCCACAGGCAGTGGCTGTGAGTGTGTGTGTGTGTGTGTGTGTTTATGAGAGAGCTAAAGTGAGAATATTTCACACAAACCATTTTCC
OTHER x50 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous sox2x50/x50 (AB) sox2 ♀+/- ♂+/-
Complex sox3x52/x52 ; sox2x50/x50 (AB) sox2, sox3

CITATIONS  (2)