header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-180705-1
TALEN Name: TALEN2-sox2
Target: sox2 (1)
Source:
Target Sequence 1:
5' - TGATGGAAACCGAGCTGAAGC - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TCCCCGTGCCCCCGGTGTTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN2-sox2 No data available
GENOMIC FEATURES CREATED WITH TALEN2-sox2
Genomic Feature Affected Genomic Regions    
x50 sox2    
GENE EXPRESSION
Gene expression in Wild Types + TALEN2-sox2 No data available
PHENOTYPE
Phenotype resulting from TALEN2-sox2
No data available

Phenotype of all Fish created by or utilizing TALEN2-sox2
Phenotype Fish Conditions Figures
otic placode pax2a expression decreased distribution, abnormal sox2x50/x50(AB) standard conditions Fig. 3 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased distribution, abnormal sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
caudal fin morphology, abnormal sox2x50/x50(AB) standard conditions Fig. 1 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased amount, abnormal sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
auditory receptor cell decreased amount, abnormal sox2x50/x50(AB) standard conditions Fig. 2 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased distribution, abnormal sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased distribution, abnormal sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased amount, abnormal sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression decreased amount, abnormal sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased amount, abnormal sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased amount, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression spatial pattern, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression decreased distribution, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
epibranchial placode pax2a expression decreased amount, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
otic placode pax2a expression decreased distribution, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 3 with image from Gou et al., 2018
auditory receptor cell decreased amount, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 2 with image from Gou et al., 2018
vagal ganglion 1 phox2a expression decreased distribution, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression spatial pattern, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased amount, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
statoacoustic (VIII) ganglion neuron decreased amount, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 2 with image from Gou et al., 2018
epibranchial placode pax2a expression spatial pattern, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
otic placode pax8 expression decreased distribution, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 3 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression spatial pattern, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
epibranchial placode pax2a expression decreased distribution, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
vagal ganglion 2 phox2a expression decreased distribution, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased distribution, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
facial ganglion phox2a expression decreased amount, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
glossopharyngeal ganglion phox2a expression decreased amount, abnormal sox3x52/x52 ; sox2x50/x50(AB) standard conditions Fig. 4 with image from Gou et al., 2018
Genome Resources:
CITATIONS (2)