header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-180409-6
Genomic Feature: zf1032
Synonyms:
Affected Genomic Regions: cyp19a1b (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN2-cyp19a1b
Lab Of Origin:
Location: Chr 25: 4897958 - 4897970 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 13 bp deleted in Exon 4 (1)
FLANKING SEQUENCE (GENOMIC)
CACAAAGTCCAGTTTGAAGAAAATATCGGGCTGTATGAGAACCGTCTGCCAGGTACTGAAATACCGGTGGATCTTTATTAGTAACTCTTTCTCTGCATTGAACAAGCATAAAAGAGAGTGTTAGAAAGGTTTCCCAAATATCCTTTCATTTAGAGCCATTTCTTACAAGCAATGGAAAGATTGAATGGATCCTAAAGGTTCTTTGACGAACTGTAGAGTCCAAATAAGAACCTTTAATTTAATAAATTCTACTTTTGAACTTCTATGGTCTGTTAGATCCATAGGAAGTGATCAGCGTTATTCGATTCATCATAATATTTTGGCTCATCAGTGTATAAGGGCGTACTCACACTATGTACAGTTGCTTTGAATAGGGCCAAAGCACGCTTGTCCCCCCCTCCCGTCTCCCCTGATGACCCGCACTCACATTACAACCGTTCCTGAATCCAATTCAGAGCACTTCCACTTCTCAAATGATGCATTGCAGACCTTTGGCACTG
GCAAACCTCCCTG/-
TGTAATTATTGCTCTTCAGGACATGGTACACAGCGGAGGATCTGAAACAGTTTTAGGTTCTACTATTTACACTTTAGTGCCCTTGTCAACACTTGATGACGTAATTGGGCGTTATGGACTTGAGTTGCAGACTATTGATCTTATTCTTGACGTACGAGCAGGCCAGCCATTGGAAGCTTTTTGGCTCAAGACTTCCGGTCTCATTCACTTCCATTGGATTTTAGACTATAAAAACAGCTCATTTTGCTGCTTGATGTTGCAAACTGATATTGTCTTATTATATTCTTCTTCTTTTGATGTATAGTCATGAACACTTGTTTGTAGAGCAAGTAGTTTGACCGTTTTCTGCCGTTTATTATAGTCATTTCTCCCATAGGTAACTGAATCGGAAGTTCTAAAACAATCACAAAAGCGAACGCGTCATCGATTATGCGCTTTTTAGTAAGAGATTTCTCTCAGCACAGCAGAGATTTCCTTAGTTATATCGCTTTAGTCGTTTG
OTHER zf1032 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous cyp19a1bzf1032/zf1032 (AB) cyp19a1b ♀+/- ♂+/-
Heterozygous cyp19a1bzf1032/+ (AB) cyp19a1b ♀+/- ♂+/-
Complex cyp19a1bzf1032/zf1032 ; cyp19a1azf1031/zf1031 (AB) cyp19a1a, cyp19a1b

CITATIONS  (2)