ZFIN ID: ZDB-ALT-170117-12
Genomic Feature: lv2
Synonyms:
Affected Genomic Regions: dio2 (1)
Type: Insertion (1)
Protocol: embryos treated with zinc finger nuclease
Lab Of Origin: Darras Lab
Location: Chr 17: 16875100 - 16875101 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 4 bp inserted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AGAGGCAAAATAACGTCAGAGACTTTTTGGCACAAAAATTGGATGAGTTATACTTGTGTTTACAGTTGTGTGGTAAAGTTCAAATGCTCCTACAATGTAAGAGAATGGCATTATCATAAGCATCTTACTACAAACAAAAATCCAGCGTGAGATCAGCAAGATTATAAGCTCTACTTTTTCCATAAGATGCTTAAAAGTTCTTACAGATGGTGTTAGAAGGGGAAAGAACAAAACCTCATTATCAGTTTAGAGCAGTGACAAAGCCCTCAAGAATATGAAGGATGTTTTTAATACTCATGCAACTGTGAATGTGAAATGTCAAACCTGGTGACATCACATAAGTATCCATAACAACAGAGGCCAATAAACCCAGCTAAAGTGGAATAGTTTTCAGTGTAGTCATGCCTCAACTTTGGTTGGCCATGAGCCAGTGCTCAAATGTATTAACATGTTGATGTTGGATTGTTTTGTTCAGGTGAAATTGGGCGAAGCTGCTCCAAA
-/CTAA
CTCTAAGGTGGTGAAAGTCACTGGCATCAATAGATGCTGGAGCATCAGCGGTAAGACCCACAACCAGTGCCACCTGCTGGACTTTGAGTCTCCTGATCGCCCGTTAGTGGTCAACTTCGGTTCGGCCACTTGACCCCCCTTTATAAGCCAGCTGCCGGTCTTCCGGCGGATGGTGGAGGAATTTTCAGATGTGGCAGATTTCCTGCTGGTCTACATCGATGAGGCTCACCCTTCAGACGGCTGGGTGGGTCCTCCCATGGAGAACTTTTCGTTTGAAGTGAGGAAACACCGAAATCTGGAGGAGAGGATGTTTGCCGCCAGGACACTTCTGGAGCATTTCTCCTTGCCTCCTCAGTGCCAGTTGGTGGCCGATTGCATGGACAATAATGCCAACATAGCCTACGGTGTGTCCTACGAGAGGGTCTGCATCGTGCAGAAGAATAAAATCGCTTACCTTGGGGGTAAGGGTCCATTTTTTTACAACCTTAAAGATGTTCGGAG
OTHER lv2 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous dio2lv2/lv2 dio2 ♀+/- ♂+/-

CITATIONS  (2)