ZFIN ID: ZDB-ALT-161003-20152
Genomic Feature: sa20364
Synonyms:
Affected Genomic Regions: txnrd2.2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 15346462 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
ACTGTAAACCATAAAAGATTCATGTTCATGTTGTTTTAATGGTTAAACTT
A/G
CTTGTCTTGTAGTTGAACTCTGTGACCCCAGTTTAGAGACCTAACATGGT
(1)
OTHER sa20364 PAGES
ZMP:sa20364 (1)
GENOTYPESNo data available

CITATIONS  (1)