ZFIN ID: ZDB-ALT-161003-19867
Genomic Feature: sa9196
Synonyms:
Affected Genomic Regions: add1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 2025540 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
ACATAACTTCATTTGTAAACTAACTAGTTTTGTTTTCTTTGCATATAGAAAGTCAACAGCCCCTTTAGAAATGTTTTCTGAAAAAAAAAATGCTAACATGTTCAACACTTATTTCCCCCACTGTAAATAGATGTGTTTACAAAATAAAAACTGATTCCTAAATTTGATTTGATTTTGCGTTCAAACATTTCACAACAAAAATAAATAAATAAAAATCCCAAAACCACATGAACACGGGTGTTTTAGCCCAGGCGTCGGGGTGCTAACCAGCTGCCCGTTCTAGCTCTGTAGCAGTACGATTCTAAACTATGAACAATAAGGTTGGCACAGACCAAGCAGTTGGTAATACAGCTTGGCACGCAGACACCGGACGAGAGAGACTGCAGCAAGGGTTTGACGTGATCGTGTGTTATGTTCGTCCACACCTTAGTCTTCGCCTTGGGGCTACCGCTGCCATCCTGCCCATCCTCAGCCGATTCGTCGGGCCGTCCTGCAGCCAG
C/T
CAGCGGGTCTTGTCCCGCTGCTGCCGCTGAAAACTGTGCTTTAACGGGGAGCGAGCACCCGAGTCACTGTCCTCTGCGTACGAGTATCCCGTGGCTGACGGGGGAATCTCAACATCACTGTACTTTTTAGTTTTATCACGCAGCGCCGGGCAACGATACGGATAGCCAGTCCTGTAGCCCTGCAGAGAGAAACAGGTTGATAAAAAAAACAAAAAAAACAACAACAACAACAAAAAAACACAATGCAAAATATGTGTGTAACACCCTCTATGAAGTCTGCATCTACAATGCTTTATGTGGGTATTCTGAATGCATTATAATGCATGCATGATTTATTTCTTGCAGCATTGCAACATTGGTAATAAATATTCAATACATAATGCATGCAAGGTAAACAACTTTCAAATATTTGTATCATTCTATAATTATTCATTACGCTCCATTATAATACTTGCACTGTAAAAAAACCTTAATAAAGTGTCAAGACAACAAATCCTTTT
(1)
OTHER sa9196 PAGES
ZMP:sa9196 (1)
GENOTYPES No data available

CITATIONS  (1)