header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-15218
Genomic Feature: sa35410
Synonyms:
Affected Genomic Regions: spred2b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 5897380 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GAGCTCTAAAGAGGAAGACTGTGAATATTTGTGGCACACCTGCTTGTCTT
T/A
GAGCCGCTCGCCGTGGATGAGGAAGTCGCTGCGGCCGGTCAGCTCAGCAG
(1)
OTHER sa35410 PAGES
ZMP:sa35410 (1)
GENOTYPES No data available

CITATIONS  (1)