ZFIN ID: ZDB-ALT-161003-14851
Genomic Feature: sa33430
Synonyms:
Affected Genomic Regions: prdm4 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 4: 14922067 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
AATTAAACCTCGCTGAACTGAACTAAACTGAACTAAAACTGGACTGAAGCAGTTTCAAATGACTAAAACTTCTACGTTAAGCTGCTTTGACACTATCTACAGTGTAAAAGCACTATAGACATAAAGAAGAATTGAATTGAATCATTTACTAACTCTAAAACAGTAATATTGAGAACATAACCATTGATTTCCATACAGTTTGTTTTTCTTACTATTGAGGTTGATGATTGCTGGTTTCTAACATTCTTCAAAATATCTTCTTTTGTATTTCGACAGAAAAAAGGAACTCAAAAAGATTTGAAACCACTTGAGGGTGAATCAATGTAAATCTTTAGGTGAACTATCCCTTTCAGTCTTTACACAATCCACTAGAAATAATACCAATCTGAAAATCTCAATCTTTTGTATTATAAAAACGTTTACTGTTGTCTGATCAGCAGTGTGCATCCATAAATAATGAATTAAGCGGTTTAGGTTTATTTAGAAATATGTTGCAAGGA
C/T
CTTCCATATTTGAGGGGTGTCCTTGTCTGACCAGTCTGTCAGTTCCACACTGCTGCAGTGCTGTCCAACCATCGGCCCAAAGCAGGTTCTGGAGGGTATGGACTCTCTAGAAAACACACCTAGAGAACCACAACAACAACAAAAATGCCTTTTCAAAATCAAAACGCAAAATCAAAACTGACTATTCCTATTGTTTCATAGAATACTGCAGAATTATTTTAATAAATGCTTAATTTTGAATTTAAACTTTTGTTAAGCCTAGTGCCCTTTTAGTATGTTAAATCTGTTAAACATTCTAAAAATATATAGTAGTCTTCATTTCTGAATCATTAAACAGGACACATTGTAATGTACAAACAAATTAAAGCTAAAAAAGCAAACCTTGAAACTGAATTGTACATAATAATTCCATGTCAAGGTGTTTCAGCAGTCTTAATGTATGCAGACTCAATGAGACTGACTGCTTTTCATTGTGCTAGATCCCAAAACAGTGGCAGAGT
(1)
OTHER sa33430 PAGES
ZMP:sa33430 (1)
GENOTYPES No data available

CITATIONS  (1)