ZFIN ID: ZDB-ALT-161003-14804
Genomic Feature: sa33209
Synonyms:
Affected Genomic Regions: dcaf7 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 31722252 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
ACAAACAGGACCCTAACTACTTGGCCACCATGGCAATGGATGGCATGGAG
G/A
TTTGTTTTTCTTTTTCTTCAGCAAGATGTCTGTAGTCTTCTTGTTGTTTA
(1)
OTHER sa33209 PAGES
ZMP:sa33209 (1)
GENOTYPESNo data available

CITATIONS  (1)