ZFIN ID: ZDB-ALT-161003-14733
Genomic Feature: sa32936
Synonyms:
Affected Genomic Regions: paxip1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 2: 29903456 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATGGTTTTGTGTTAAATGTAAATGCTGAGATGGGAACAGCGTCATCTTAC
C/A
GATGTTCTTCAGGAAATACTCTCGGCACAGATGAGAGTCATTTTCACAGG
(1)
OTHER sa32936 PAGES
ZMP:sa32936 (1)
GENOTYPESNo data available

CITATIONS  (1)