header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-10663
Genomic Feature: sa19381
Synonyms:
Affected Genomic Regions: col22a1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Unmapped
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TTAGAGGGCTGATTGGTGCTCCTGGTCCAAATGGAGTAAAAGGAGAAAAG
G/T
TAGAGTTGTGCAATTTATTATCTAATTTTATTATTTTATTTCATATTTTC
(1)
OTHER sa19381 PAGES
ZMP:sa19381 (1)
GENOTYPESNo data available

CITATIONS  (1)