ZFIN ID: ZDB-ALT-160601-9601
Genomic Feature: sa44212
Synonyms:
Affected Genomic Regions: itga11b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 25: 1349971 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
ACGTTAGCATCACCGTCACAGGATGGCTCAATCTTCACACTTTATTAGCC
G/T
TGAGTATGTTAGAAATAAGTAACGAATAACTGACAAAAATGAGTTTGTCT
(1)
OTHER sa44212 PAGES
ZMP:sa44212 (1)
GENOTYPESNo data available

CITATIONS  (1)