ZFIN ID: ZDB-ALT-160601-8180
Genomic Feature: sa42413
Synonyms:
Affected Genomic Regions: rbmx (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 31861434 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILSNo data available
FLANKING SEQUENCE
GTTTCAGTGTTCAGGCCACCGATGAAGAGCTTCCCAGGTCGGTCTGCCTC
T/G
GCCATTTTTTTCCAGTAACGTTAATGCCACTGCAAAAATATACATTTCTC
(1)
OTHER sa42413 PAGES
ZMP:sa42413 (1)
GENOTYPESNo data available

CITATIONS  (1)