header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-160601-8023
Genomic Feature: sa42205
Synonyms:
Affected Genomic Regions: adka (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 25199113 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CTTCTGACTCGGTTGATCTACAATGCTCAACCGATGCTTGTGTTTACTGT
A/G
CCTGAGCTTTTTTTCCTCGAGTTTAATCCTCTTTGCTTTAGGTTCATCGG
(1)
OTHER sa42205 PAGES
ZMP:sa42205 (1)
GENOTYPES No data available

CITATIONS  (1)