ZFIN ID: ZDB-ALT-160601-7823
Genomic Feature: sa41953
Synonyms:
Affected Genomic Regions: pde6c (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 5135578 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TGTAAGCAGACATTATTCACCATTTAGTAAATGTGTTGCGAATGTTTTTC
A>T
GGTATTCAGCAAGTACATCATATTTGCCACAGTCATCGCCCTGCAGCATT
(1)
OTHER sa41953 PAGES
ZMP:sa41953 (1)
GENOTYPESNo data available

CITATIONS  (1)