ZFIN ID: ZDB-ALT-160601-77
Genomic Feature: sa20476
Synonyms:
Affected Genomic Regions: taf1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 36589618 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GCTCGGCTGTTTCCTCCTCGCTGGCTGTGATCTCTGTAATGAGTGAACCC
A/T
AACCCAGCGTTCCCAGACCAGCCAAATGCTTCTTTGACTCCTGAGAGAAT
(1)
OTHER sa20476 PAGES
ZMP:sa20476 (1)
GENOTYPESNo data available

CITATIONS  (1)