ZFIN ID: ZDB-ALT-160601-6379
Genomic Feature: sa40077
Synonyms:
Affected Genomic Regions: flr (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 28848088 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Missense, Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
CTCTATTTTTCAAAGTCTTGCTCAAATTCCATTATGTTATTTTAGTGTATTCACAAATACAGACGTGGACAAATTAGTTTGTACTCTTCCATTGAGATATATGAGTGAAAAACTGATAAAATAAGTGAATAGGTAATAATTAATACAAAATGATTCTAAACTGAAAATAAACTAATGAAAATCTGATATTTCTTTTGAATTGTGGTTCAACAGAAGCATTAAAATAGGAAAACTAATGAAACTGGCCTGGACACAATCGAAGAGTACCAACAACTTTGTCCACATCCGTATCTATCCTAGAGCTCTGTCCAGCTGCATAAACAGTGTTACATAACATTCTGGTTCTCACAACAGTGTAGCAGATGCACTGTCTTTGCCTTTTTAGACTTAACTTTTTATCAACTTGATGTTTACCAGTTTTACTGGTGTGATTTTTCATGTGATGTTACTTAGTTATTTTCGCTTGGCATGACACTGACGTCCTGTTTTTCAGCTTGGAA
C/T
AGACACATGGTTCTACGCTAAGAGATGTTTTCTCTCGCTGCTGGAAAACATGGCCAAGCACATGATCATGCTCAGAGATTCAGTAGTGCAAGAGTGCATTCAGTTCCTTGAGCACTGTGAATGTAAGTATATGGTATCTTAAAGCACCAGCCTATTAGAGGGCCGCAAGATGACTTTAAAATAAGACAAAATATGATTGAAAATAAGCTAAAACGAAAGGTAATTGATTCAATCTAGACTTGTGATTTTTATTTAAGAACAAGAGATGTTAAAATGTAGGTTTTAAACTTCAATACTAGTTATATTAAGCTCTAAATTATTTTATAAGCCACTGTAGAATTACAGTATTAAAAAATCTTAAAGGTCACATGAAATTAAAATTAAAAAGAATTTAATGGTAATTTCATGCTGTTAGTTTTAAGGATGTCTATAGACTATTTTAATGTAGTCATGCCATTGGCCCTTGAACATTTCCTGCGAGTTCAAACTATTTCATAACT
(1)
OTHER sa40077 PAGES
ZMP:sa40077 (1)
GENOTYPES No data available

CITATIONS  (1)