ZFIN ID: ZDB-ALT-160601-5718
Genomic Feature: sa37882
Synonyms:
Affected Genomic Regions: lnx2a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 24: 21655326 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
ATTCGTCCGTCACGTGACAGGCAGCCATGGGGCTGGACGCTCGTCACAAATATGGGCAGTTCCCCACTTTTGCTGCCCCGTCCTCCTGCCACAGTCATTCCCAGAGACTCATGAGGCTCCTTCTTCACAGTGATGTGTTTCTCTTTACAGTTCACACACTGGGAGAGATCCTGCAACACACACTCATATTAGAAAAGCATCAGAGCATCAAGTCTAAACGTGTCTCAAAGGTATGGATAAAGAAAAAGGAAGCCCGTTTCTAAACTGACACTCTGATCGGCTCTCTGTAGAGTGCTGTTCGTCATCCCAACGGGATCAGCTGTACTTCCGAATTGATCTCATAATAGATCCGACAAGGAGTAATTAAGGTTGTGGTCTGAACTCATGGAAAACTGGAGGCTACCCAGATGCTTCGTAAATAGGGCTCCCTAATTACGTCTCCACAATGCTAAAATAGATTCTGCAACACAAACAGACTTGGCCGCAAGGCGTGTGTACTC
(1)
OTHER sa37882 PAGES
ZMP:sa37882 (1)
GENOTYPES No data available

CITATIONS  (1)