ZFIN ID: ZDB-ALT-160601-4513
Genomic Feature: sa36297
Synonyms:
Affected Genomic Regions: chrna2a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 17: 6090880 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CACAGGATGAGAAGAATCAAATGATGACGACAAACGTTTGGCTGAAACAG
G/A
TGATGATCTTTATGTTTATTTCTAATGACCAATAAATTGGGCGACACGGT
(1)
OTHER sa36297 PAGES
ZMP:sa36297 (1)
GENOTYPESNo data available

CITATIONS  (1)