ZFIN ID: ZDB-ALT-160601-3796
Genomic Feature: sa35331
Synonyms:
Affected Genomic Regions: srsf2a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 12: 31721530 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILSNo data available
FLANKING SEQUENCE
AAAAGAGGAGAAACAAAATCATTTAAAAAGATGTAGACCAAATTACAATA
A/G
CCTTTCGGTCTGATATATGGATAATTTGGGTATCCTCAGACGGACATCTG
(1)
OTHER sa35331 PAGES
ZMP:sa35331 (1)
GENOTYPESNo data available

CITATIONS  (1)