ZFIN ID: ZDB-ALT-160601-3396
Genomic Feature: sa34785
Synonyms:
Affected Genomic Regions: dct (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 9: 53350329 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CCACCTGTGACCAATGAGGAGATTTACATCGCATCTGAACAGCTCGGATA
T/G
TCATACTCCATCGACCTCGAAGGTAAATAAACAAAAACACAGGCTACTTC
(1)
OTHER sa34785 PAGES
ZMP:sa34785 (1)
GENOTYPESNo data available

CITATIONS  (1)