Genomic Feature

ihb66

ID
ZDB-ALT-151023-6
Name
ihb66
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 21: 19449267 - 19449279 (GRCz11) (1) Details
Nucleotide change
TGGTGATGTTTGG/-
Variant Notes
Between 496 bp and 510 bp of the wild-type slc45a2 coding sequence,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
13 bp deleted from position 496 to 510 (1)
Transcript Consequence
None
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
AAAGACATGTGGTACAGGTGAATTGGGTAGGCTAAATTGTCCATAGTGTATGAGTGTGTGTGTGAATGTCTGTGTGGATGTTTCCCAGAGATGGGTTGCGGCTGGAAGGGCATCCACTGCGTAAAAACTTGCTGGATAAGTTGGCAGTTCGTTCCGCTGTGGTGACCCCGGATTAATAAAGGGACTAAGCCGAAAAGAAAATTAATGAATGAATGTAATCCGGTAACCATTGTATCCATTGTAATAAAAAATCCATATGGAAGTCAATGGCAACCATTTTCCACCAATAATCAAAATACAATCTTTTGTATTCATTTGAGGAAAAAATCAAACTGGTGAGCTACAAGTAGAGAGAATTTTCAGTCTTGATGTTTCTTAAAGTTGTATACTAAAGTATTTATTAACATTGAGTGGATTTACTGAACTAAGCATGACGTTGTGTTTTTCACCCGCAGCCATAATATCAGACAGAAATTTAAAAAGGACATGGGCCATCGTGG
TGGTGATGTTTGG/- AGTGGTTTTGTTTGACTTTGCCGCAGACTTCATTGACGGACCCATTAAAGCCTATTTGTTTGATGTGTGTTCTCATCGGGATAAAGAGCGGGGTCTTCATTACCATGCTTTACTCACAGGTAAGAACTAATAACGCTCATTTAGCTTGGCTTTCTTACAGCAGAAATGTACATTGGCTGGGTCAGTTGGCGTTTCTGTGTGAAGTTTGCATGTTCTCCCCATGTTTGCGTGGACTTCCTTGTGGTGCTCCATTTTCCGTTTCCGCTATGTATAACATATGCTGGATAGTTAGCGGTTAATTCCGCTGTGATGAATAAAGGGACTACGAATGAATGAATAAATGAAAAGCATTTGTCTTTAAAGAGCTTTATTGTTACCTTGAGAGTTTCAGAATATTGCTGTTGCTGTGAATATGTTTGTAAGTGTTTCTCATTATATAGCTTGACATAACGTATAGGATTTTTTAATCCATAATGTGTTATTTTGAAAGACTATTGTGT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations