header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-151027-2
CRISPR Name: CRISPR2-slc45a2
Target: slc45a2 (1)
Source:
Target Sequence:
5' - GGCCATCGTGGTGGTGATGTT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR2-slc45a2 No data available
GENOMIC FEATURES CREATED WITH CRISPR2-slc45a2
Genomic Feature Affected Genomic Regions    
ihb64 slc45a2    
ihb65 slc45a2    
ihb66 slc45a2    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR2-slc45a2 No data available
PHENOTYPE
Phenotype resulting from CRISPR2-slc45a2
No data available

Phenotype of all Fish created by or utilizing CRISPR2-slc45a2
No data available
OTHER CRISPR2-slc45a2 CRISPR PAGES No links to external sites
CITATIONS (2)