header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-131217-17809
Genomic Feature: sa24539
Synonyms:
Affected Genomic Regions: snai2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 24: 35390665 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AAGCTGTCGGACGCTGAGAAGTTTCAGTGCGGTTTGTGTAACAAGTCCTA
C/A
AGCACGTATTCGGGACTCATGAAGCACAAACAGCTGCACTGCGACGCACA
(1)
OTHER sa24539 PAGES
ZMP:sa24539 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous snai2sa24539/sa24539 snai2 ♀+/- ♂+/-

CITATIONS  (2)