ZFIN ID: ZDB-ALT-131217-16487
Genomic Feature: sa22366
Synonyms:
Affected Genomic Regions: sfrp5 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 39946947 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GTCTCGTGGTCCAATAGGTTTGGCAGGCGCATCTTTTTGTAGCCCACGTT
G/T
TAGCAGAGCCGCAGGTCGGCTGGGATATCCACACACTGCGGCTGCTTGGC
(1)
OTHER sa22366 PAGES
ZMP:sa22366 (1)
GENOTYPESNo data available

CITATIONS  (1)