ZFIN ID: ZDB-ALT-131217-12825
Genomic Feature: sa16629
Synonyms:
Affected Genomic Regions: esco2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 20: 39349832 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
GAAATTTGATTCATATCGCAATGTATAATGCAGCAAAACAAAATATCGCAATGTGAGATTTTTCCAATATTGTGCAGCCCTAGCATCTTATCTATCCATCTAATCTATCTCTTAATTTCTCTGTTTTAGACCTCAGAAAAAGGGGAAGTTGTCTCCACCGCTGAACAGCAGCACTCCTTCAGCTCTGACCGCAACTCCTGCTCTTAAAGCCAAAGAGAGGAGCATGCTGAGGAGAGAGATGAAGAAGCAAACCGACAACCAGCTCATCATCGTGAGTAGATCAACCTATTAGAAATAAGAAAATAAATAAAAAAATCAATCTGTGGTTTTTGACCTGTTGTTTATGGTTGGCATGTCTGCTCTTTAGGATGCTGGTCAGAAGCAGTTTGGAGCCACTACCTGTGCATCCTGTGGGATGCTGTACAGCACAGACAGTCCAGAGGACAACTTTCAACACACACAGTTCCATCAGCGCTTTCTGGACACCATTAAGTTTGTGG
T/A
GAGCCATCATGATGTTTATTAATATTACAACAGATCGTATATTGGATACACATATGGACGTGTACTCGGAAAAAAGAAACCCCAAAATGCCAGTAATGAAACAGAAACCAGATTGTGAGGCATTTTCTTATTGATTGCCCTATTTTTAATGTTATCAGACAATGATTTTTAGCTGGAGAGACTTTAAACGAAATATTTTTTTAACATGAATCTTTCCAAATTTGTACAATTTAGCCCTTTAGCCCTTAAACTGTTTTAGATTTTTATCTTGTATATTATTATTATTTATAAATCTTATGTATTTATTGCTGTTGATGACTTGTTATTGTTAATGTTTAGAATTATAGAAGTGATATCTATACAATAATGAACATTATCAGTTTTTTTTTGACATAGGGAAGCTGATGTGGCTTATAATGACTCCACTCTCTCTCTCTACAGCTGAACAGTTTTTCTGCAGAACATTTTTTCAACATCAGTTTGTTTGTTTTTAGGGCTGG
(1)
OTHER sa16629 PAGES
ZMP:sa16629 (1)
GENOTYPES No data available

CITATIONS  (1)