ZFIN ID: ZDB-ALT-131217-12716
Genomic Feature: sa14350
Synonyms:
Affected Genomic Regions: dcaf7 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 31721833 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TGTATGTTTATTTTCTGTTTTTCAGGGACATCTAGTATTGACACCACTTG
T/A
ACAATCTGGGGTCTAGAGACAGGACAGGTCCTGGGAAGAGTCAACCTAGT
(1)
OTHER sa14350 PAGES
ZMP:sa14350 (1)
GENOTYPESNo data available

CITATIONS  (1)