Genomic Feature

sa13736

ID
ZDB-ALT-131217-12163
Name
sa13736
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation
Protocol
adult males treated with ENU
Lab of Origin
Stemple Lab
Current Source
European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 12: 10140280 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C (1)
Transcript Consequence
Splice Site (1)
Protein Consequence
None
Sequences
Flanking Sequence
CAGTGTTTTTGCTCAGTCATTCTTTAAGGAAATATCCATAATTTTGTAAATGTTTATTAAATATATTAATAGTTTAATTTTAAGTCTTGTGAGGAAGGATTTGTTGGGAATTGGTTGGATAGGATTGTTTAAGATTAACTGTTGCGTACAGTTAAGGTCTCCAGCACTCAGTAATTGAAATAATATTTGAACATATGTCCGTGTTGAGTCATGTTTTTACACATCTGCTCCACATTTTCAGAGTGAAGAGGCGTAAGATGGCTGACAAAGTCCTCCCACAGAGGGTGAGTTTAGCCAGAGTAGCATAAATCAGTTTTTTGTGTGTGTGTGTGTGTTCCTTAAGTGCATAGTTTCTCATGGTTTCGCTGTTCTCCAGATCAGGGATTTGGTCCCAGAGTCTCAGGCATACATGGACCTTCTGGCCTTTGAAAGAAAACTGGACCAGACCATTGCTCGCAAACGCATGGAGATACAGGAGGCCATCAAAAAGCCCATCACGG
T/C AGATGTTATCAATTGGAGTAGAAATACAGACGTGACTTTTGATTTTGTTTATGTTAAAGTGATAGGTCATTGTATACTTTACCATTTTTAATTTCTCTCTCTCTCTCTCTCTGTGCAATAAAAACAAATATTAACTGGATGTTGGTAACCAAACAGAAACATAAACAGCTTTACAAAGACCTGAGGTTGAGTAAATGATGAGAGAGTTTACCTTTCTCTTTGGAGCAACATCAAGAAACTAACCAATTTGTTTAACCCATTCATTAACTAACCTAGTCTACGGTGACCTAGGCTCCATTTACACTGCATGGTTCAAGTGACTCAATTCGGATTTTTTTTTCTTCCATGTGGCGTCAGATATGGCGCATGTACATGTAAGCAGGAAAAAATCACATGGATTCCGATTTACTCAAATCAGATTTAGGCCTTGTTCAAATGTGGAAATGTATCCAGTACGAATCGGATCTGTGTCCTTGTGTCTGCAGTAGGGATGGGTACAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations