ZFIN ID: ZDB-ALT-130411-776
Genomic Feature: sa10874
Synonyms:
Affected Genomic Regions: lca5 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 23: 31384679 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Missense, Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AACATATCAGTGTCTTTGTTTTGTCTCAAAGCACATTTATAAAATTACTTAAATGTCCTAATTGAACTATAGCCTACACCTCACTTAGCCTGAGCCCTCTCTGTAAAATTAGTCCTTCAAGATCATTAAAAAAATCTTCCAACTCCCTAACTTTGAATTGTAATGTACATAAAATATTATAATATCTATAATATATAGACCAACATCAATTCTATTCATGACTGTAAACTTGAGCTTCTGCTTTTAGCTGTATTATCAGTGAATTATGGTGGCTTCTACATTCCTACCTCTGTTTCCTTTAAAGTTCTTCTCATTTGAGCTGAGATCTTGATCTAGTCTTTGCCTCTCCACATCTTTCAGCAGCTCTGTTTGTCTTTCTCTCTCATGCAGTGTCTCTTTTTCTTTCTCCTGTTCTCTTGCAGATTCCATGTGTCTTTCTTTCTCCCTTTCTCTCCAAAACTCTTGAATCTTCCATTCCTTCGATTCTCTCGTCCTGTGCT
C/A
TCTGCTTTGCTGATCCTGCTAACATGTTTTATAAAAAAGAAAATAAATGACAAACAAAGGGTCAGCCTGGAGTAAAAACACAGTACAAAATGATATAACAAAACGGTCATCTAACTGAAAGGTTATGCATGCGTTTAAAGTGATAGGCTGTACAAAAATGAAAATGGTCAGCATTCTGTCACCTTCATGAATTTGGCATTGGTTAAAAATACAAAAATCAATGACATTCGGAATCACTGATGTCAAGCCTAACACAAAATAGCTGAATACAGATCATCAGCAGTTGCAGAGAAAATTATCTACTTTGTAGTTATGTGTCATCTTTTTATGAGATCTCCATTGAATTGAAGTGTAAAATACATTCAGTGCTATATATTGCTGTTTTGAGAGTTTCACAAACAGAAAAATAAGAACGTTATGAACCATAAATTACATGAAGGTTGAGTAAATGATGACTTATTTTCCTTTTTGGATAAACTAGACTTTGATTCTTTATTTAA
(1)
OTHER sa10874 PAGES
ZMP:sa10874 (1)
GENOTYPES No data available

CITATIONS  (1)