ZFIN ID: ZDB-ALT-130411-688
Genomic Feature: sa10776
Synonyms:
Affected Genomic Regions: irx2a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 16: 560791 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
TAGCTGTCAGAGATTAACAGCCTACGCACCTTTTTTGGATTCTGCATTGGAGGCCCTGAAGTGAGCTTCAGTCTGGTTTGGATTAGTCTTTATTAGCGGCTCTCCAGTCTGTTTATGAAGGAGTCCCTCTGCGGCGGAGTTGTAGCGCAGTATCCCCTGGCCCTGAAGCGGGCTGAAGTTGCCATAGTTTGTGTAATTACTATAAAACGGAGAAGTGTAATAAAGAGGTCTTCCTAGTATGGAGGTGGCGGGGTAAACCGCGCCCGCCGGGGACGCGCCGGGCGCGCTGGAGGTCAGAAGGCCGACACCCGGGGGACAGTTCTGCTGCTTGGGGTCCGAAGTGGCGATCTCTGCTAATGACCACAGCTTAGGCTTGACGGTTTGGTTTTGACCGTCCAGGCATGTTTTGTTGGTGCTGTTCTCCCGGTGATGATGGGTCAATAGAGGCGCCTCCACCCCGGTCAGAGGAGAAGAGGTCACCGGTTTGGGTGACGCGCCTC
G/A
CTGCCTTTCCTCCCCGAGATCCGTCGCCTCGCATTTGTCCTGGATTTCAGCTCCAGAATCGCAAACAAGGTCTCCGGTCCGACACGTGACCTTCTCCCCGTCCGACTCCACCGAGCACGAGTGGTCTGTCAGGGCATCGACGTGCAAACTGATGCCTGGAGACAGAAGCGGCACCGCAGTGAGATTATTGCGTTAAAAACTAATAATAAAACAGTCATAAAATTGCACTGATGCATTTTAGAAATATGAATCCATATTAGCGTTAATGCACTCTAATAATTATTGGTGTAATACGGGGTACACACACTGCTGGGTTATTTTTAAATTAAATAAATAGGGCCGAAATTAACGCAATGTTTGGATTAGTCTGAAGTGTATTAAATTTGGGTTTAAAATAACCCAGCATTTCTTAGAGCTAAAATCTTGGGTTAAATATAAACACACACAGCGGTTGGGTTAAAATGTATAATTTAAATAAAAAATAACTCAACATAATATTG
(1)
Comment Citation
irx2a sa10776 cRNA was sufficient to rescue pronephric tubule phenotypes in  ... Marra et al., 2019
OTHER sa10776 PAGES
ZMP:sa10776 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous irx2asa10776/sa10776 irx2a ♀+/- ♂+/-
Heterozygous irx2asa10776/+ irx2a ♀+/- ♂+/-

CITATIONS  (2)