header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-130411-579
Genomic Feature: sa10654
Synonyms:
Affected Genomic Regions: jag2b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 20: 21448376 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TTATTTGTGTCTGTGCAGGAGCTGGTTCATGGAGGTTACCACTGTCAGTG
T/A
CCTGCGGGGTTTGTGGGCTTACACTGTGAAGTCTCAAGGAATAAATGTGC
(1)
OTHER sa10654 PAGES
ZMP:sa10654 (1)
GENOTYPES No data available

CITATIONS  (1)