header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-130411-5238
Genomic Feature: sa9634
Synonyms:
Affected Genomic Regions: ptpn22 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 23: 26449018 (Zv9) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AGTTGCTGTTTGAAAGATATCTGGCAGCACTTGAAGCACCAAGTAACAAG
G/A
TTGGATGAGAACAAACTAAATACAACAAAGATGCCAAATATTACATTTCC
(1)
OTHER sa9634 PAGES
ZMP:sa9634 (1)
GENOTYPES No data available

CITATIONS  (1)