ZFIN ID: ZDB-ALT-130411-479
Genomic Feature: sa10539
Synonyms:
Affected Genomic Regions: adgrv1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 48779430 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CAGTCCATGTGGCAGAAGCAAATGCTCTTGTTGCCCTAACCATACAGAGG
A/T
GAAAGGGCTTAATGGGAAGGGTACGAGTGGCCTATCGGACACTAAGGGAC
(1)
OTHER sa10539 PAGES
ZMP:sa10539 (1)
GENOTYPESNo data available

CITATIONS  (1)