ZFIN ID: ZDB-ALT-130411-4496
Genomic Feature: sa15969
Synonyms:
Affected Genomic Regions: adgrv1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 48825166 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
ATGAGATTTTTGAGTTGCAACTCACTGGTGCCACAGGAGGTGCCATACTT
G/T
GAGCTCAGCTAATTGCACGAATAACGATTGCCAAGAGTGACTCGCCAAAC
(1)
OTHER sa15969 PAGES
ZMP:sa15969 (1)
GENOTYPESNo data available

CITATIONS  (1)