ZFIN ID: ZDB-ALT-130411-4288
Genomic Feature: sa15744
Synonyms:
Affected Genomic Regions: stat3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 17070131 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: at position 73 (1)
FLANKING SEQUENCE
TCTTCCACAACCTGCTGGGCGAGATCGATCAGCAGTACAGCCGCTTCCTG
C/T
AGGAGAACAACGTCCTGTACCAGCACAACCTGCGGCGCATCAAGCAGCAC
(1)
OTHER sa15744 PAGES
ZMP:sa15744 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous stat3sa15744/sa15744 stat3 ♀+/- ♂+/-

CITATIONS  (2)