ZFIN ID: ZDB-ALT-130411-3951
Genomic Feature: sa15367
Synonyms:
Affected Genomic Regions: taf1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 36563052 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AGACAACAAAGAGCTCTGACTCTCACACAGACTCACCTCCGCTAAAGTCT
G/A
CTTGCAAACGTTCACAATTTCCAGAGCAGTTTTTGTATAAGGACTATCAG
(1)
OTHER sa15367 PAGES
ZMP:sa15367 (1)
GENOTYPESNo data available

CITATIONS  (1)