ZFIN ID: ZDB-ALT-130411-3317
Genomic Feature: sa14621
Synonyms:
Affected Genomic Regions: gtf2f2a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 1: 34695902 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
AACGTGTGTTGCGTGGAGGAGGTACATTAAATACACATGAAACAAGTCTAATAAAAACACATTTTAACGTTACAGTATTAACAGGCATGTCGGAGAAAGGAGAGGTAGATTTAACGGGGGCGAAACAGAACGCTGGTGTATGGCTGGTTAAAGTAAGTGATTTAAATGCATCGACGAGGATTTAAGCTGCTTTAGCTTTAGCATGTAAAATGCTACATGTGGTGATATGTTTAATATGCTTTTTACTGTTATTGTTGCGTTGTTTTAAAGCCACTGTTGTATAATTTTCATAAAGGTCCCAAAGTACTTGTCACAGCAATGGACCAAAGCAACAGGGAGAGGAGAAGTTGGAAAGCTCCGAATTAGCAAGTATGTAGAAATTTATGTGTATAACGTATAATCTGCACATTATGAGGAGCTAGAAGTTATGTTGTTTATAGTTAACATTTAAACATTCACACATTTCTCTTGTTCATACAGGAATCAAGGAAAGGCAGAGG
T/A
AACTTGAATGTCTTCAAGCATGTAGTATTTTATATAATGACTTGTCTTTTGGTGAATTTGGTGTTTTTTTGGCTTGATTGTTTGATTGATTGACAGGTGTCATTCACACTCAATGAGGAGCTGACCACAATAGAGACTATTGGAGAGAAGACCTCTATGGTACGAGCCCCTAGAGAGCATCCTTTCACTTTGCAGACAGTTGGTGGACAAACTCTGGCTGTTTTTACTGAAAACTCTTCAGGTGAGAATCAAAATTGAAATACAACACTGAATTACACTAAATTCTGTGTCCAGACTAGATTTAGAAACTCTGAGGGGTTCAAATATATCACTACTCCTTAATTAATCTTAATGAGAGTGTGTAAATGGTTTGTTAATTTAGTACTAAACGGTGAGAAACAACAAAATCAGCTAAATCCACCAAAATCCACCAAGACAGTGTAATTAGTTGAAAAATCACCAATGATGCAATTAGAAATCATTTTACCAAACATTAAACG
(1)
OTHER sa14621 PAGES
ZMP:sa14621 (1)
GENOTYPES No data available

CITATIONS  (1)