ZFIN ID: ZDB-ALT-130411-3085
Genomic Feature: sa13465
Synonyms:
Affected Genomic Regions: agbl2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 25: 28634940 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
CCTCTTTAATTTTTTAAAGCAACTTATTAACTATTTTAAAATTTCATTGTCACTAATCAGCAACAAACATATTACTCATAATGTATTTTGTCCATATATGGAAACAACATGGCTATGTTTCGAATGATTGAAATTTAAATAATTGATGACGTAAATGTGATTAACAATTTAAAAAGAGGGTGGAGGGAGTAATTGCTTTAAACACGTAGGAAGGCATTTGAAACGTTTGTGGTTTTATTTCTCATAAGAATGTAAAGTGATAAAAAACTTCAAAACAAAAACGTTTAAATGAGTGATGACTTAGCTACTTCCTGAATCAATTCACAACTTTAAAACATAAAAATCCATGATCCAAGAGGTCTACTGGAATATTCAACATATTGCTATTTAAATATTCTGTTATTAAAACTGTCTTCACACTTTATCACTAACTCAAATTTAACAATATACTGCATTAATAATAGAAGAAAAGCCTTAATACCGATATGCTGGATTTTGTC
A/T
CAGATCACATCACACTCTATGGGCCAGCGGACGCCCTGGAACGGACAGGAGGTAGATGGGATTGTGAAGAGGTCCAAAGGGTCCCTTAGACGTGGAATAGGACGCTCCCCATCAAAGTCAAACACAAGCTGCCGGGTCCTGAGTGCTTTGTTTAAACTGAAAAAGTCTGGAAAATAAATTAATAAAACACAGACGTATTATTGCAGTCTAATTTCTCAGCCAACAAACAGGCTGCAGTTAAAAGATATACGAGGAGCATTTGTTGCAGCTGTGTTGTAACCAAGACGCACAATTAATTCACTGGTACATGTTCCCTAAAACTATTATGTGTTCTTACAGTCTGAATCTTTTATAAAGGCTATGAATTTCAAATGGGAACTAGCTACTTAGACCCAAGTGTTAAGTTTCGAATGACAACTTGACAAATGAGAGGAATGCCATAATTAAGGTGGCAGTGGTAATTATTTTACACATAATACTGCATCTTTACATCATCTCTA
(1)
OTHER sa13465 PAGES
ZMP:sa13465 (1)
GENOTYPES No data available

CITATIONS  (1)