ZFIN ID: ZDB-ALT-130411-2991
Genomic Feature: sa13359
Synonyms:
Affected Genomic Regions: snap29 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 1848717 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
CCAGCTGAAAACATTTATTTAAACAAGGTAACTTTCAAATAAAATAGTTTTATTCAAGTTTAAACTTACAGAATTAGCATAGATGCATACATTAAAGCAAATAAATGGTTTTAAAATTTTGACATCCTCCTCTTGTTCCAAACCGGTTTGAGATTATTTCTTCTGTTGAACACAAAGGAAGATATCCTGAAGAATGCTGGAATAAACAGCCATTGACATCTACAGTATTTTTGTTCCTACTATGAATGTTAAAGGCTGCTTTCTCCCCAACATTCTTCAGAATATCTTCCTTTGTGTTCAGCAGAAGTAAGACACTCATAAAATGCTTAAAACTTTTACTTGAGTGCGAGTAAATGATCAGGAAATGTGAATTCGGGGTGAACTGACCCTAAGTGACTAAATGTAAATGTTACAATAAATTGCTTTGTCATTTTTTGAATGTCTGATGATTTTAGGCTACAGACGGCGCTTGCGGAGAGCAAACAGCAAGAAGACAAATA
T/A
CAGGCCAGTCATCCAAACCTCAGGAAACTGGAAACATCTGGTAAACACACACACCACCAACAACAACAACACACACACACTTTCTTCCCTTAAGAGCAAGTATCAGCTAGTGATAGGATTCAGTCTCTTAAAAATGCTGAGTGGTATTTTAGGCCAAATAAAACAAACTCAACATTTGGTGAAATATAAAATATTATTTCATTTAAATTGCACAGCAGATGGATTCGCTAATATTTGACCCAGTGTTTTTTTTTTCTTTTTTCAAAGCACATGAATTGACGTCTGCTGTTCAGAATAGTATAAATGCAGAGAAAACTACACGAGAACAATTTACAAACACCGATTAATTTTTTTTTTTTATCAGTGCATTGCATGCTACATATTGATGGTGTGCAGTGAGGGGTGTGTCAAGTGTTCCTCACAGTGTTCCTCATTTATGTTTTCTTAAATCTTACACAGTCACATGTCTTAAAAACGCATCCAAATGAAAATCTTTCAGT
(1)
OTHER sa13359 PAGES
ZMP:sa13359 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous snap29sa13359/sa13359 snap29 ♀+/- ♂+/-
Complex snap29sa13359/sa13359 ; rw0Tg snap29

CITATIONS  (2)