header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-130411-2287
Genomic Feature: sa12573
Synonyms:
Affected Genomic Regions: col15a1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 2: 23948838 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TAATTATTTATAATGACTCATCTATTTTAAAGGGTCCACCAGGTCCACCT
G/T
GACCTCCAGGGCCACCAGGACGAGTGATTGGCCTCAATGGAGTAAGTTTT
(1)
NOTES
Comment Citation
A single base change (G/T)results in the introduction of a premature stop codon  ... Guillon et al., 2016
OTHER sa12573 PAGES
ZMP:sa12573 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous col15a1bsa12573/sa12573 col15a1b ♀+/- ♂+/-
Heterozygous col15a1bsa12573/+ col15a1b ♀+/- ♂+/-

CITATIONS  (2)