ZFIN ID: ZDB-ALT-130411-1888
Genomic Feature: sa12125
Synonyms:
Affected Genomic Regions: amot (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 37517009 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AAATCTGTTTTGTTGTTTCTGTGAGGCCTCAGCAATGTAATCTCTTTACA
G/T
ATGGAGACTGAGATCCAGATGGTGTCAGAAGCTTACGAGAACTTGGCTAA
(1)
OTHER sa12125 PAGES
ZMP:sa12125 (1)
GENOTYPESNo data available

CITATIONS  (1)