ZFIN ID: ZDB-ALT-130411-1799
Genomic Feature: sa12030
Synonyms:
Affected Genomic Regions: dhx37 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 4529542 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GGCCTGAACATCAGAACATTTGACATGAACTTTAGAAATTAAATGAAAGT
A/G
CCGAGCAGAACCATCAGATCTCCGAGCAGAAGAGACGCTCCTTGTCCTGC
(1)
OTHER sa12030 PAGES
ZMP:sa12030 (1)
GENOTYPESNo data available

CITATIONS  (1)