ZFIN ID: ZDB-ALT-090611-7
Genomic Feature: hu2787
Synonyms:
Affected Genomic Regions: fmr1 (1)
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Hubrecht Institute
Location: Chr 14: 20160043 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>T at position 432 (1)
Transcript Consequence: Premature Stop (1)
Protein Consequence: Polypeptide Truncation: at position 113 (1)
FLANKING SEQUENCE (GENOMIC)
TGGATTGAACATGAAACAATTAAGTTGTCCCAAAACAAATCTCAAAAATTGTGTTGTTTAAGCTATTTTTAAATAATTAGTTTAAACAAGCAATTTTTTGAGTGTTCACTGTAAAAATGAAGGCTTCGACACTTATCAACATTTATTCATGTTTTGCCAATACAAATCGATTAAGGTAACTCTCTCTCTTTTTGGCAAATTTAAGTTGATTGAACATAAAAGAATTAAGTTGTCCCAAAACAAATCTCAATAATTATTATTTTTTTGTTTATTTAGCTTGTTTTAAATAAGTTTGAACAAGCCAGTTTTTTTTTCGTGTAGTAGATTAAAACATTAAACATTACATTGATTCAAATTTGTTTTATGCTTGCATGAAGTTGTATGTAAATTTATGTATTTGCTAATTATTTGTGTTCACTTTCCTGCTCTTTTAGTTTTACGTTATAGAATATGCAGCCTGTGATGCCACCCTAAATGAAATCGTCACATTAGAGAGGCTA
C/T
GACCTGTGAACCCCAACAAAGCAGCAACAAAGAACACCTTTCTCAAAACCAGACTAGATGTTCCTGAAGACTTGAGACAGATGTAAGTTGGTAGCTTTTTCATTATTTTAGTGGGGATTCCTGCAGCATTGGACAATACATTGAGAAATCCAGTCATAAAAAAATCATTAACTAATGCAGGATGTCATGGAGTTTGGCCAATTTTGGATAAATAAATCAAAAGCAGAGTTTTAAACTTAATCAAACTACAAAGCAGAATAGTGTATGTGAATATTAAACTGCAATGACAAAATGTGAACTTCTCTCCAGAGCTGCTTTAAAAATCCTTTATGATAATTTTTATGGTTTAATCCAGGACCACAAAACCATAAAAGTCATAAATGTCTTTTTTTTTTTTAACTGTGATTTTATATATCTTCTTAAAGCCAAATAAGTAAACTTTTCATTGATGTGTAATTTTTTAGGTTAAGACAATATTTAGCCCAGATACAACTAATTGA
(1)
OTHER hu2787 PAGES
ZMP:hu2787 (1)
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous fmr1hu2787/hu2787 (TL) fmr1 ♀-/- ♂-/-
fmr1hu2787/hu2787 fmr1 ♀+/- ♂+/-
fmr1hu2787/hu2787 (TL) fmr1 ♀+/- ♂+/-
fmr1hu2787/hu2787 (AB) fmr1 ♀+/- ♂+/-
Heterozygous fmr1hu2787/+ fmr1 ♀+/- ♂+/-
fmr1hu2787/+ (WIK) fmr1 Unknown
fmr1hu2787/+ (TL) fmr1 ♀+/- ♂+/-
fmr1hu2787/+ (AB) fmr1 Unknown
Complex fmr1hu2787/+; fmr1hu2898/+ (TL) fmr1
Unknown fmr1hu2787 fmr1 Unknown

CITATIONS  (13)